View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16991_high_28 (Length: 375)
Name: NF16991_high_28
Description: NF16991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16991_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 19 - 357
Target Start/End: Original strand, 55171305 - 55171643
Alignment:
| Q |
19 |
tgttctctgtaatgtaactgcagattgtatctctgtcaacaatcattatctctattttttctggacttcccttctcctcttccaatacaacaagcaaatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
55171305 |
tgttctctgtaatgtaactgcagattgtatctctgtcaacaatcattatctctattttttctggacttcccttctcctcttctaatacaacaagcaaatt |
55171404 |
T |
 |
| Q |
119 |
gtcctttgcattcaggtaatctcttgggatgtggtactctgtttgactaggttgtccaagaggggagaggaatgacatccagtgacgaccgatgcttttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171405 |
gtcctttgcattcaggtaatctcttgggatgtggtactcttcttgactaggttgtccaagaggggagaggaatgacatccagtgacgaccgatgcttttt |
55171504 |
T |
 |
| Q |
219 |
ccgttcacccaaatcattccttttcccataccagtcatcctgatggcaactggacctcttccctctggtgtggcaaatcttgtcttcaaccaggagagag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
55171505 |
ccgttcacccaaatcattccttttcccataccagtcatcctgatggcaactggacctcttccctctggtgtggcaaatcttgtcttcaaccaggagagtg |
55171604 |
T |
 |
| Q |
319 |
cacgtgtttctcctgtgactggatcccattgaaccttct |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171605 |
cacgtgtttctcctgtgactggatcccattgaaccttct |
55171643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 153 - 271
Target Start/End: Complemental strand, 27724384 - 27724266
Alignment:
| Q |
153 |
tactctgtttgactaggttgtccaagaggggagaggaatgacatccagtgacgaccgatgctttttccgttcacccaaatcattccttttcccataccag |
252 |
Q |
| |
|
||||||| |||| |||| | ||||||||| |||||| | ||||||||||||||| ||||||| || || |||||||||||||||||| ||||||| |
|
|
| T |
27724384 |
tactctgattgagtaggctttccaagaggagagaggtagctcatccagtgacgaccaatgctttcaccattaacccaaatcattccttttgccatacctt |
27724285 |
T |
 |
| Q |
253 |
tcatcctgatggcaactgg |
271 |
Q |
| |
|
||| | |||||||||||| |
|
|
| T |
27724284 |
ccattccgatggcaactgg |
27724266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University