View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16991_high_38 (Length: 313)
Name: NF16991_high_38
Description: NF16991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16991_high_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 270
Target Start/End: Original strand, 35837198 - 35837452
Alignment:
| Q |
19 |
agttcatatggcaagctctctcacccatcaccaaaagtaagtataatcactaaatattattgtatttttcttctttaatttggttccagtaattaaacaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35837198 |
agttcatatggcaagctctctcacccatcaccaaaagtaagtataatcactaaatattattgtttttttcttcttttatttggttccagtaattaaacaa |
35837297 |
T |
|
| Q |
119 |
gcccttcaa-tttttagcattaaaactggtttctttg-nnnnnnnagtttaactgacaatgtggtactgttggnnnnnnnctctccacatttgg-ttagt |
215 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
35837298 |
gcccttcaattttttagcattaaaactggtttctttgttttttttagtttaactgacaatgtggtactgttggtttttttctctccacatttggtttagt |
35837397 |
T |
|
| Q |
216 |
tggttgttttgatttctgaataagtgattatcgtttaactgacttaaaaaagttg |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35837398 |
tggttgttttgatttctgaataagtgattatcttttaactgacttaaaaaagttg |
35837452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University