View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16991_high_48 (Length: 252)
Name: NF16991_high_48
Description: NF16991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16991_high_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 113 - 218
Target Start/End: Original strand, 39273272 - 39273382
Alignment:
| Q |
113 |
atcactatccctgttacacaactact-----atactgtgtgttgaattggttttaagcttgctggttttttagttaaattttaaaattcaatatgttgtc |
207 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39273272 |
atcactatccctgttacacaactactatactatactgtgtgttgaatttgttttaaggttgctggttttttagttaaattttaaaattaaatatgttgtc |
39273371 |
T |
 |
| Q |
208 |
ataaaattatg |
218 |
Q |
| |
|
||||||||||| |
|
|
| T |
39273372 |
ataaaattatg |
39273382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 39273185 - 39273243
Alignment:
| Q |
18 |
gcaaggtgagagagttcttgaatgggtgatgatgtaagcttctttgccgcacgcgacaa |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39273185 |
gcaaggtgagagagttcttgaatgggtgatgatgtaagcttctttgccgcacgcgacaa |
39273243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University