View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16991_high_61 (Length: 236)
Name: NF16991_high_61
Description: NF16991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16991_high_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 63 - 165
Target Start/End: Original strand, 14426494 - 14426596
Alignment:
| Q |
63 |
ttgtcccaattattcaaatcacccttttagaattccacctccagccagaacatcgaacaatcaccatgcaaataacccacttctacactgatgagcctag |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
14426494 |
ttgtcccaattattcaaatcacccttttagaattcaacctccagccagaacatcgaacaatcaccatgcaaataacctgcttctacaccgatgagcctag |
14426593 |
T |
 |
| Q |
163 |
aag |
165 |
Q |
| |
|
||| |
|
|
| T |
14426594 |
aag |
14426596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 162 - 220
Target Start/End: Original strand, 14426694 - 14426752
Alignment:
| Q |
162 |
gaagggaatattctcattgttaccataggacatagatgaaggcccttgagaggcagcag |
220 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14426694 |
gaagggaatattctcattgttgccataggacatagatgaaggcccttgagaggcagcag |
14426752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University