View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16991_low_36 (Length: 342)
Name: NF16991_low_36
Description: NF16991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16991_low_36 |
 |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 324
Target Start/End: Complemental strand, 3804630 - 3804313
Alignment:
| Q |
1 |
gtaattaggcttaattaaacgcacttttgaccccctatgtttgtcatggtagcaatttacagagggtggtgatgcaaaccatgcttttcatgaggttatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3804630 |
gtaattaggcttaattaaacgcacttttgaccccctatgtttgccatggtagcaatttacagagggtggtgatgcaaaccatgcttttcatgaggttatt |
3804531 |
T |
 |
| Q |
101 |
agtggtggagaaatggaacaccgtcgttttgtgtggatgaggaaggaagtatgcaaggatgatgaactcgttgagcaaaaagagaagaaagttgatgatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3804530 |
agtggtggagaaatggaacaccgtcgttttgtgtggatgaggaaggaagtacgcaaggatgatgaactcgttgagcaaaaagagaagaaagttgatgatg |
3804431 |
T |
 |
| Q |
201 |
agcgtttgatgagaaagaatcgccatcgccatcgccatgcaaaacatattcgtgatcattatcataagaagaagaatagtggaggtggttttcctgtgat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3804430 |
agcgtttgatgagaaagaatcgccatcg------ccatgcaaaacatattcgtgatcattatcataagaagaagaatagtggaggtggttttcctgggat |
3804337 |
T |
 |
| Q |
301 |
tccggttcacaaaaatggtgaaga |
324 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3804336 |
tccggttcacaaaaatggtgaaga |
3804313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 15 - 58
Target Start/End: Original strand, 655529 - 655572
Alignment:
| Q |
15 |
ttaaacgcacttttgaccccctatgtttgtcatggtagcaattt |
58 |
Q |
| |
|
||||| ||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
655529 |
ttaaatgcacttttggccccctatgtttgccatggtagcaattt |
655572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 15 - 58
Target Start/End: Original strand, 19437315 - 19437358
Alignment:
| Q |
15 |
ttaaacgcacttttgaccccctatgtttgtcatggtagcaattt |
58 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19437315 |
ttaaatgcacttttgaccccctatgtttgtcatggtagcaattt |
19437358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 15 - 58
Target Start/End: Original strand, 19573464 - 19573507
Alignment:
| Q |
15 |
ttaaacgcacttttgaccccctatgtttgtcatggtagcaattt |
58 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19573464 |
ttaaatgcacttttgaccccctatgtttgtcatggtagcaattt |
19573507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 62 - 128
Target Start/End: Original strand, 26913363 - 26913429
Alignment:
| Q |
62 |
gagggtggtgatgcaaaccatgcttttcatgaggttattagtggtggagaaatggaacaccgtcgtt |
128 |
Q |
| |
|
||||||| |||| ||||| ||| ||||||||||||| | |||||||| ||||||||||||||||||| |
|
|
| T |
26913363 |
gagggtgatgattcaaacaatgtttttcatgaggttgtaagtggtggtgaaatggaacaccgtcgtt |
26913429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 234 - 309
Target Start/End: Original strand, 26913547 - 26913619
Alignment:
| Q |
234 |
gccatgcaaaacatattcgtgatcattatcataagaagaagaatagtggaggtggttttcctgtgattccggttca |
309 |
Q |
| |
|
||||||||||| |||||||| |||||| ||| |||| |||||||||||||||||||||| || |||||||||| |
|
|
| T |
26913547 |
gccatgcaaaaaatattcgttatcattgtcacaaga---agaatagtggaggtggttttccattggttccggttca |
26913619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 14 - 58
Target Start/End: Complemental strand, 51391563 - 51391519
Alignment:
| Q |
14 |
attaaacgcacttttgaccccctatgtttgtcatggtagcaattt |
58 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
51391563 |
attaaacgcacttttgacccctcatgtttgttatggtagcaattt |
51391519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 15 - 58
Target Start/End: Original strand, 19026 - 19069
Alignment:
| Q |
15 |
ttaaacgcacttttgaccccctatgtttgtcatggtagcaattt |
58 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19026 |
ttaaacacacttttgaccccttatgtttgtcatggtagcaattt |
19069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 15 - 58
Target Start/End: Original strand, 26918 - 26961
Alignment:
| Q |
15 |
ttaaacgcacttttgaccccctatgtttgtcatggtagcaattt |
58 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26918 |
ttaaacacacttttgaccccttatgtttgtcatggtagcaattt |
26961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University