View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16991_low_41 (Length: 301)
Name: NF16991_low_41
Description: NF16991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16991_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 296
Target Start/End: Original strand, 16390148 - 16390443
Alignment:
| Q |
1 |
acaggaatcctcactttatgtcctctgcttcccttcattaaaacctctccaaaactgtatgttcccgtcactgagcgaacagtaagtgtcacggtaaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16390148 |
acaggaatcctcactttatgtcctctgcttcccttcattaaaacctctccaaaactgtatgttcccgtcactgagcgaacagtaagtgtcacggtaaacc |
16390247 |
T |
 |
| Q |
101 |
tacctgatgcaccagctctgatggtcattgctggtggggtgatttcaatggcaactgctggttgcattctagctgtcaacacatatgtctcttccttggc |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16390248 |
tacgtgatgcaccagctctgatggtcattgctggtggggtgatttcaatggcaactgctggttgcattctagctgtcaacacgtatgtctcttccttggc |
16390347 |
T |
 |
| Q |
201 |
aacatttgtgacttttcgggttatagtttgagttctcacaagatgtgaaactgtaattgatggagtgtttaaattatatgggtggcctatgcttct |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
16390348 |
aacatttgtgacttttcgggttatagtttgagttctcacaagatgtgaaactgtaattgatggagtgtttaaattatatgggtggcccatggttct |
16390443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 52929604 - 52929409
Alignment:
| Q |
1 |
acaggaatcctcactttatgtcctctgcttcccttcattaaaacctctccaaaactgtatgttcccgtcactgagcgaacagtaagtgtcacggtaaacc |
100 |
Q |
| |
|
||||| ||||| || ||||| |||||||| || ||||||||||| ||||||||||| || |||| |||||||| || || |||||||| | ||| |
|
|
| T |
52929604 |
acagggatccttaccttatgccctctgctccctttcattaaaacttctccaaaactataacttcctgtcactgattgagatgtcagtgtcacagaaaatt |
52929505 |
T |
 |
| Q |
101 |
tacctgatgcaccagctctgatggtcattgctggtggggtgatttcaatggcaactgctggttgcattctagctgtcaacacatatgtctcttcct |
196 |
Q |
| |
|
|| ||||| || | |||| |||||||| || ||| ||| |||||||||||||||||||| |||||| ||||| | |||||| || ||||||| |
|
|
| T |
52929504 |
gacgtgatgtgccgccgttgatagtcattgcaggagggttgacttcaatggcaactgctggttccattctggctgtgatcacataggtttcttcct |
52929409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University