View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16991_low_53 (Length: 252)

Name: NF16991_low_53
Description: NF16991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16991_low_53
NF16991_low_53
[»] chr1 (2 HSPs)
chr1 (113-218)||(39273272-39273382)
chr1 (18-76)||(39273185-39273243)


Alignment Details
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 113 - 218
Target Start/End: Original strand, 39273272 - 39273382
Alignment:
113 atcactatccctgttacacaactact-----atactgtgtgttgaattggttttaagcttgctggttttttagttaaattttaaaattcaatatgttgtc 207  Q
    ||||||||||||||||||||||||||     ||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |||||||||||    
39273272 atcactatccctgttacacaactactatactatactgtgtgttgaatttgttttaaggttgctggttttttagttaaattttaaaattaaatatgttgtc 39273371  T
208 ataaaattatg 218  Q
    |||||||||||    
39273372 ataaaattatg 39273382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 39273185 - 39273243
Alignment:
18 gcaaggtgagagagttcttgaatgggtgatgatgtaagcttctttgccgcacgcgacaa 76  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39273185 gcaaggtgagagagttcttgaatgggtgatgatgtaagcttctttgccgcacgcgacaa 39273243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University