View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16991_low_55 (Length: 250)
Name: NF16991_low_55
Description: NF16991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16991_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 21 - 181
Target Start/End: Original strand, 42858080 - 42858241
Alignment:
| Q |
21 |
tcaaactgttaatctgattgaaagtttgaaacattgctgactcgagcatgatagaattcattctatcggataatgtcaaaattgtctctaacaaatagtc |
120 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||| ||| || ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42858080 |
tcaaactgttaatctgattgagagtttgagacattactggctgtagcatgatagaattcattccatcacataatgtcaaaattgtctctaacaaatagtc |
42858179 |
T |
|
| Q |
121 |
attaatttcaggcaaagtattctatgttgagtgtc-actaatatatcatccacttggagtgt |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
42858180 |
attaatttcaggcaaagtattctatgttgagtgtctgctaatatatcatccacttgaagtgt |
42858241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University