View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16991_low_71 (Length: 228)
Name: NF16991_low_71
Description: NF16991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16991_low_71 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 66 - 228
Target Start/End: Complemental strand, 8915799 - 8915637
Alignment:
| Q |
66 |
tcctattagaaagtgtttcaactcaaacattgattctgcagttgtaacatattgacaaatctttcttgtgtcatctaacacatgagatatgttttctggt |
165 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8915799 |
tcctattataaagtgtttcaactcaaacattgattctgcagttgtaacatattgacaaatctttcttgtgtcatctaacacatgagatatgttttctggt |
8915700 |
T |
|
| Q |
166 |
tcgttaacataattcgtagcggtgacactctcacctgacatgaatcctctacaatagttgcac |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8915699 |
tcgttaacataattcgtagcggtgacactctcacctgacatgaatcctctgtaatagttgcac |
8915637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University