View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16992_high_4 (Length: 283)
Name: NF16992_high_4
Description: NF16992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16992_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 269
Target Start/End: Complemental strand, 19171925 - 19171672
Alignment:
| Q |
16 |
gatttggttcatgctgtggaacattccaagaatttttctgttgatcatgctaaagatcataaagatttttgtcgttcgaggtgtcactgattcgttggtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19171925 |
gatttggttcatgctgtggaacattccaagagtttttctgttgatcatgctaaagatcataaagatttttgtcgttcgaggtgtcactgattcgttggtt |
19171826 |
T |
 |
| Q |
116 |
caatcatcatcaatggaagaaagaggaatattggcttgacagtttctgtgcattatgtaatttccatttctttcttcttcttttggtatgtatgtaatgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19171825 |
caatcatcatcaatggaagaaagaggaatattggcttgacagttgctgtgcattatgtaatttccatttctttcttcttcttttggtatgtatgtaatgt |
19171726 |
T |
 |
| Q |
216 |
atgattcattgnnnnnnnncttgatttggagtgttgaatattgaaatggcacag |
269 |
Q |
| |
|
|| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19171725 |
ataattcattgttttttttcttgatttggagtgttgaatattgaaatggcacag |
19171672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University