View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16992_high_6 (Length: 252)
Name: NF16992_high_6
Description: NF16992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16992_high_6 |
 |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0014 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 43 - 236
Target Start/End: Complemental strand, 67082 - 66891
Alignment:
| Q |
43 |
aatcaacttaataattcacacaatcatctgattgctacaatctaagaagacactttgaaaattatatacagtatgacactacttctttctatcgatgttg |
142 |
Q |
| |
|
||||||||||||||||||||||| || || ||||| ||||| | | ||||||||||| ||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
67082 |
aatcaacttaataattcacacaaccacctaattgccacaatttgattagacactttgagaattatatagagtatgacactacttctttctatcgatgtgg |
66983 |
T |
 |
| Q |
143 |
gactatttctagtggaccttttctttatattagttgttgggggttatgagagtctcagatatgaaagttttgtaatttaa-ctgtttgcatttct |
236 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
66982 |
gactatttctggtggaccttttc-ttatattagttgttgggggttat--gagtctcagatatgaaagttttgtaatttaacctgtttgcatttct |
66891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University