View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16992_low_10 (Length: 252)

Name: NF16992_low_10
Description: NF16992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16992_low_10
NF16992_low_10
[»] scaffold0014 (1 HSPs)
scaffold0014 (43-236)||(66891-67082)


Alignment Details
Target: scaffold0014 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 43 - 236
Target Start/End: Complemental strand, 67082 - 66891
Alignment:
43 aatcaacttaataattcacacaatcatctgattgctacaatctaagaagacactttgaaaattatatacagtatgacactacttctttctatcgatgttg 142  Q
    ||||||||||||||||||||||| || || ||||| ||||| | |  ||||||||||| ||||||||| ||||||||||||||||||||||||||||| |    
67082 aatcaacttaataattcacacaaccacctaattgccacaatttgattagacactttgagaattatatagagtatgacactacttctttctatcgatgtgg 66983  T
143 gactatttctagtggaccttttctttatattagttgttgggggttatgagagtctcagatatgaaagttttgtaatttaa-ctgtttgcatttct 236  Q
    |||||||||| |||||||||||| |||||||||||||||||||||||  ||||||||||||||||||||||||||||||| ||||||||||||||    
66982 gactatttctggtggaccttttc-ttatattagttgttgggggttat--gagtctcagatatgaaagttttgtaatttaacctgtttgcatttct 66891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University