View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16992_low_11 (Length: 248)
Name: NF16992_low_11
Description: NF16992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16992_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 33967010 - 33967196
Alignment:
| Q |
1 |
acaacatgctgaaaatgtaatgcatgtttgacattcttaagagaagattgtgaaaatgaaaaaatgatggagaatggtatgttttagtttggtttatata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33967010 |
acaacatgctgaaaatgtaatgcatgtttgacattcttaagagaagattgtgaaaatgaaaaaatgatggagaatggtatgttttggtttggtttatata |
33967109 |
T |
 |
| Q |
101 |
tactagttatgtttccaaaatgcgcgtaatcgtaggttttggtttcgaattcagtcatagaactgcaataagattaaaactctaaac |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33967110 |
tactagttatgtttccaaaatgcgcgtaatcataggttttggtttcgaattcagtcatagaactgcaataagattaaaactctaaac |
33967196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 170 - 232
Target Start/End: Original strand, 33967212 - 33967274
Alignment:
| Q |
170 |
aagattaaaactctaaacaaaatatttggtcatatattatggtcctatccgactcgagagatt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
33967212 |
aagattaaaactctaaacaaaatatttggtcatatattatggtcttatctaactcgagagatt |
33967274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University