View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16994_high_16 (Length: 231)
Name: NF16994_high_16
Description: NF16994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16994_high_16 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 86 - 231
Target Start/End: Original strand, 44378285 - 44378430
Alignment:
| Q |
86 |
tgtgatgaatgaacgaatgagaaattggaatttgaaagaagaataactatttgtttaatcaaatgacgtattgagtttgtactaactattgtttgtgtgt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44378285 |
tgtgatgaatgaacgaatgagaaattggaatttgaaagaagaataactatttgtttaatcaaatgacgtattgagtttgtactaactattgtttgtgtgt |
44378384 |
T |
 |
| Q |
186 |
gatttggctatatttagagagccattaatttattttaggcgttgtt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44378385 |
gatttggctatatttagagagccattaatttattttaggcgttgtt |
44378430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University