View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16994_low_19 (Length: 209)
Name: NF16994_low_19
Description: NF16994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16994_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 23 - 135
Target Start/End: Original strand, 12514637 - 12514749
Alignment:
| Q |
23 |
tcccatacttatcttccccatgttagtctcttcaattcaatcacaatcataatcacaacttacccacctctttcttttcttcacttttctctctttgcaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12514637 |
tcccatacttatcttccccatgttagtctcttcaattcaatcacaatcataatcacaacttacccacctctttcttttcttcactgttctctctttgcaa |
12514736 |
T |
|
| Q |
123 |
agtacattgcaaa |
135 |
Q |
| |
|
||||||||||||| |
|
|
| T |
12514737 |
agtacattgcaaa |
12514749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University