View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16995_high_11 (Length: 260)
Name: NF16995_high_11
Description: NF16995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16995_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 9 - 222
Target Start/End: Original strand, 30892794 - 30893009
Alignment:
| Q |
9 |
gagatgaattttacccacacttaatgtatgtttggattaaaaattgtaaatgtgctttttaatcaaa-gttatttttcaattgtaaatatacatttttta |
107 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30892794 |
gagatgaatttttcccacacttaatgtatgtttggattaaaaattgtaaatgtgctttttaattaaatgttatttttcaattgtaaatatacatttttta |
30892893 |
T |
 |
| Q |
108 |
caaatgttttacgtttggatattttcatcgtaaacgtataata-nnnnnnncttgagagaagaacgtataattgacaatatacatttatgtttctttgct |
206 |
Q |
| |
|
||| ||||||| ||||||||| |||||| |||||||||||||| |||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30892894 |
caagtgttttatgtttggatactttcattgtaaacgtataatatttttttccttgagggaagaatgtataattgacaatatacatttatgtttctttgct |
30892993 |
T |
 |
| Q |
207 |
tcatctcaagagatat |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
30892994 |
tcatctcaagagatat |
30893009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University