View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16995_high_12 (Length: 256)
Name: NF16995_high_12
Description: NF16995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16995_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 3 - 244
Target Start/End: Original strand, 47293761 - 47294003
Alignment:
| Q |
3 |
ggagttccattgcggatggatggaaccatgtgagattttattttatttttgtcaagtagcttaggaggtagaaattcaactttgaatnnnnnnnnntttg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47293761 |
ggagttccattgcggatggatggaaccatgcgagattttattttatttttgtcaagtagcttaggaggtagaaattcaactttgaataaaaaaaaaattg |
47293860 |
T |
 |
| Q |
103 |
ttttatttt-ttgctattatgatagcttattataaacaattttcctaagttttctccctgcattattcaccatcttaagcacattggttcttacttttgc |
201 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47293861 |
ttttatttttttgctattatgatagcttattataaacaattttcctaagttttctccctgcactattcaccatcttaagcacattggttcttacttttgc |
47293960 |
T |
 |
| Q |
202 |
atctgttttctctcttttctgcattttatattatatttatatt |
244 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
47293961 |
atctgttttctccctttcctgcattttatattatatttatatt |
47294003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 151 - 231
Target Start/End: Complemental strand, 7971582 - 7971504
Alignment:
| Q |
151 |
ttttctccctgcattattcaccatcttaagcacattggttcttacttttgcatctgttttctctcttttctgcattttata |
231 |
Q |
| |
|
|||| ||| |||| |||||| ||||||||||||| |||| |||||||||||| ||||||||| ||| ||||||||||||| |
|
|
| T |
7971582 |
ttttttccttgcactattcatcatcttaagcaca--ggttattacttttgcatttgttttctcccttctctgcattttata |
7971504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University