View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16995_low_11 (Length: 316)
Name: NF16995_low_11
Description: NF16995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16995_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 30599943 - 30599627
Alignment:
| Q |
1 |
gcattaaaaattccaactttttaaagaactatagcttcaatgaactaaattgtctccgttggatttaggagactcgtttctgcactcgtcatacaattct |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30599943 |
gcattaacaattccaactttttaaagaactgtagcttcaatgaactaaattgtctccgttggatttaggagactcgtttctgcactcgtcatacaattct |
30599844 |
T |
|
| Q |
101 |
tgggtgggatttcctctttagacacctaataat-------------------atggtagttttaatagtttgaggtgtctgcgaataattactagatgta |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30599843 |
tgggtgggatttcctctttagacacctaataattgctctttagatatcgttgatggtagttttaatagtttgaggtgtctgcgaataattactagatgta |
30599744 |
T |
|
| Q |
182 |
taaagagcaaatttctttttgggtttattggcagctttcagtccatgatcaatattttgtagcgatagtcatgaacacataaagtaccatgaaacttttt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
30599743 |
taaagagcaaatttctttttgggtttattggcagctttcagtccatgatcaatattttgtagcgatagtcatgaacacataacgtaccatgaaatttttt |
30599644 |
T |
|
| Q |
282 |
gtcaacggagatactca |
298 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
30599643 |
gtcaacggagatactca |
30599627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University