View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16995_low_13 (Length: 303)
Name: NF16995_low_13
Description: NF16995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16995_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 17 - 291
Target Start/End: Original strand, 47894185 - 47894459
Alignment:
| Q |
17 |
aataaattcattttctgtttgcatcatgttggtcttccactaagctttgattttgttcctcaatcctcattcatttttcacattgagtctgtttgtgctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47894185 |
aataaattcattttctgtttgcatcatgttggtcttgcactaaactttgcttttgttcctcaatcctcattcatttttcacattgagtctgtttgtgctt |
47894284 |
T |
|
| Q |
117 |
gtatgaaatagtggacatggttgatgccttcatgtaatatagaacattgattgattgaatttgtttttgtggcagtatttcggaccaagttttatccacg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47894285 |
gtatgaaatagtggacatggttgatgccttcatgtaatatagaacattgattgattgaatctgtttttgtggcagtatttcggaccaagttttatccacg |
47894384 |
T |
|
| Q |
217 |
acggaagcaagatgtcaatatcacctccacaatatgtggacccttatgcactcttggaagatgaaaggatatctc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47894385 |
acggaagcaagatgtcaatatcacctccacaatatgtggacccttatgcactcttagaagatgaaaggatatctc |
47894459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University