View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16996_high_1 (Length: 203)
Name: NF16996_high_1
Description: NF16996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16996_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 69 - 188
Target Start/End: Complemental strand, 8074358 - 8074235
Alignment:
| Q |
69 |
atacagagtcaatgtgctctta----tttttgataatgctagcttgtggtaccagtagaaactctcaaggaacagtttgtgaatatcattaacaaacttg |
164 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
8074358 |
atacagagtcaatgtgctcttaatttttttttataatgctagcttgcggtaccagtagaaactttcaaggaacagtttccgaatatcattaacaaacttg |
8074259 |
T |
 |
| Q |
165 |
ggaaatatttatctacttacttct |
188 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8074258 |
ggaaatatttatctacttacttct |
8074235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 16 - 63
Target Start/End: Complemental strand, 8074443 - 8074396
Alignment:
| Q |
16 |
cataggctaagctaagattttctgttgcctagttaacaagtaatgttt |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8074443 |
cataggctaagctaagattttctgttgccttgttaacaagtaatgttt |
8074396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University