View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16996_low_1 (Length: 281)
Name: NF16996_low_1
Description: NF16996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16996_low_1 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 281
Target Start/End: Original strand, 51295382 - 51295628
Alignment:
| Q |
20 |
ttaggattccatgattactaacaccgattacttgttatgaagcactacacaacaaggggaaagaaaaattaacgatctcttttatctaaagtaggtatca |
119 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| ||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51295382 |
ttaggattccataattactaacaccggttacctgttatggagcactacacaacaaagggaaagaaaagttaacgatctcttttatctaaagtaggtatca |
51295481 |
T |
|
| Q |
120 |
acacaccaaacgaaaatcttaaagagatgccataagtatatgggtttttctcatttcaccctttcatgccaaacattattgagtttgatcatgtgtcact |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51295482 |
acacaccaaacgaaaatcttaaagagatgccataagtatatgggtttttctcatttcaccctttcacgccaaacattattgagtttgatcatgtgtcac- |
51295580 |
T |
|
| Q |
220 |
tattgtgagatagaggggtgaacttctatatttggtcttacttgtcataattgattattcta |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51295581 |
--------------ggggtgaacttctatatttggtcttacttgtcataattgattattcta |
51295628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University