View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16997_high_2 (Length: 256)
Name: NF16997_high_2
Description: NF16997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16997_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 15 - 241
Target Start/End: Complemental strand, 2365978 - 2365756
Alignment:
| Q |
15 |
actcgacaggtattaaccattcattcattcattcaagagacccttgagaagccaagctacgagaaaacattcgtgttagtgttctgccgttaaccaagcc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |||| ||| ||||||||||||| |
|
|
| T |
2365978 |
actcgacaggtattaaccattcattcattca----agagacccttgagaagccaagctacgagaaaacattggtgttggtgtcctggcgttaaccaagcc |
2365883 |
T |
|
| Q |
115 |
gcaaagaactgatggatgacacaattaatataatacattgaacaaggaaaactcttagcagacaccatcgaggctaggttggtgaagaaaatggtaagta |
214 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2365882 |
gcagagaactgatggatgacacaattaatataatacaccgaacaaggaaaactcttagcagacaccatcgaggctaggttggtgaagaaaatggtaagta |
2365783 |
T |
|
| Q |
215 |
agcatacaaccatagtgggaaggttgt |
241 |
Q |
| |
|
||||||||| ||||||||||||||||| |
|
|
| T |
2365782 |
agcatacaatcatagtgggaaggttgt |
2365756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 140 - 241
Target Start/End: Original strand, 2365563 - 2365664
Alignment:
| Q |
140 |
taatataatacattgaacaaggaaaactcttagcagacaccatcgaggctaggttggtgaagaaaatggtaagtaagcatacaaccatagtgggaaggtt |
239 |
Q |
| |
|
||||| ||||||||||||||||||||||| | | |||||||||||||||||||| |||||||||| || ||||||||||||| |||||||| |||||| |
|
|
| T |
2365563 |
taatagaatacattgaacaaggaaaactcccaactgacaccatcgaggctaggtttgtgaagaaaagggcaagtaagcatacattcatagtggcaaggtt |
2365662 |
T |
|
| Q |
240 |
gt |
241 |
Q |
| |
|
|| |
|
|
| T |
2365663 |
gt |
2365664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University