View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16997_low_6 (Length: 250)
Name: NF16997_low_6
Description: NF16997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16997_low_6 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 136 - 250
Target Start/End: Complemental strand, 7414030 - 7413916
Alignment:
| Q |
136 |
actggttttcaatcaactaannnnnnncatttagcctataatattagcttctaaccgttgaaatgcatacatacaaaatagtcataaacctaaagcaaac |
235 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
7414030 |
actggttttcaatcaactaatttttttcatttagcctataatattagcttctaaccgttgaaatgtatacatacaagatagtcataaacctaaagcaaac |
7413931 |
T |
|
| Q |
236 |
ttgctgaaaatgcat |
250 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7413930 |
ttgctgaaaatgcat |
7413916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 17 - 87
Target Start/End: Complemental strand, 7414149 - 7414079
Alignment:
| Q |
17 |
tttgtgacatggagaggcagtcatgtgacactggttgtacgaaaaattcagaggctatttgtcaatcccac |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7414149 |
tttgtgacatggagaggcagtcatgtgacactggttgtacgaaaaattcagaggctatttgtcaatcccac |
7414079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 47840545 - 47840586
Alignment:
| Q |
163 |
catttagcctataatattagcttctaaccgttgaaatgcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47840545 |
catttagcctataatattagcttctaacagttgaaatgcata |
47840586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 62
Target Start/End: Original strand, 47840416 - 47840452
Alignment:
| Q |
26 |
tggagaggcagtcatgtgacactggttgtacgaaaaa |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47840416 |
tggagaggcagtcatgtgacactggttgtacaaaaaa |
47840452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University