View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16998_low_4 (Length: 250)
Name: NF16998_low_4
Description: NF16998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16998_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 44648948 - 44648731
Alignment:
| Q |
16 |
atcagacgtgatattatgattttattaaagctagtgtagtttttgcaaaaccacatgacacatcataattctgctaaattcatcatcaatccaaacatgc |
115 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44648948 |
atcagacgtgatactatgattttattaaagctagtgtagtttttgcaaaaccacatgacacattataattctgctaaattcatcatcaatccaaacatgc |
44648849 |
T |
 |
| Q |
116 |
acgcattttcagtttataatttggttatgtatgtaaatttcatttatatttttatgtcttagttgagttattatattttatatggtggtatgaataggaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44648848 |
acgcattttcagtttataatttggttatgtatgtaaatttcatttatatttttatgtcttagttgagttattatattttatatggtggtatgaataggaa |
44648749 |
T |
 |
| Q |
216 |
aaggagggtgtggttagg |
233 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44648748 |
aaggagggtgtggttagg |
44648731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University