View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16999_high_1 (Length: 238)
Name: NF16999_high_1
Description: NF16999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16999_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 4702428 - 4702209
Alignment:
| Q |
1 |
cctcgacatcgttaacaaaatcatcataattgacactaacagtatcttgagtgctaacccccctgttaatggtaaaattgaatgtttgcccctctttgag |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4702428 |
cctcgacatcattaacaaaatcatcataattgacactaacagtatcttgagtgctaacccccctgttaatggtaaaattgaatgtttgcccctctttgag |
4702329 |
T |
 |
| Q |
101 |
taaaattggttgtgacacatccccacttctaacttcaggaccctgcaaataaaaattagttaataccacgcaatacctagcatgttacataaatacattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4702328 |
taaaattggttgtgacacatccccacttctaacttcaggaccctgcaaataaaaattagttaataccacgcaatacctagcatgttacatcaatacattt |
4702229 |
T |
 |
| Q |
201 |
aactatcagtatcttagtgt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4702228 |
aactatcagtatcttagtgt |
4702209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 11593526 - 11593478
Alignment:
| Q |
105 |
attggttgtgacacatccccacttctaacttcaggaccctgcaaataaa |
153 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||| ||| |||| |
|
|
| T |
11593526 |
attggttgtggcaaatccccacttctaacttcaggaccctacaattaaa |
11593478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University