View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16999_high_10 (Length: 343)
Name: NF16999_high_10
Description: NF16999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16999_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 30 - 322
Target Start/End: Complemental strand, 35696427 - 35696135
Alignment:
| Q |
30 |
ctggattgagccatgcaactgcataggctttgattgatttagaaacgggtgcgaggtcttgtgctgatatgacgttgatttctaggagttggaagggagg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696427 |
ctggattgagccatgcaactgcataggctttgattgatttagaaacgggtgcgaggtcttgtgctgatatgacgttgatttctaggagttggaagggagg |
35696328 |
T |
 |
| Q |
130 |
tgctagcatcgacattgttgtgatgaggttgattttgttgtgaaaattgaaatgataatgctatggggtgattgatggagggggagcagccggtgttatg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696327 |
tgctagcatcgacattgttgtgatgaggttgattttgttgtgaaaattgaaatgataatgctatggggtgattgatggagggggagcagccggtgttatg |
35696228 |
T |
 |
| Q |
230 |
gctgagactcacccaccaccttgtgaattggacaaatggaaatgattctttctttctctctaaggggataaacaacatgatttggtgatgatg |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35696227 |
gctgagactcacccaccaccttgtgaattggacaaatggaaatgattctttctttctctctaaggggataaacaacatgatttggttatgatg |
35696135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University