View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1699_high_4 (Length: 295)
Name: NF1699_high_4
Description: NF1699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1699_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 19 - 168
Target Start/End: Complemental strand, 39105713 - 39105564
Alignment:
| Q |
19 |
cgaggatctccttgcctcatacgtataatgtgacgaaagcttattcaagttactagatgtgattttatttgagactctttactctatttcttggttaact |
118 |
Q |
| |
|
|||||||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39105713 |
cgaggatctccttgcctcatacctctagtgtgacgaaagcttattcaagttactagatgtgattttatttgagactctttactctatttcttggttaact |
39105614 |
T |
 |
| Q |
119 |
taagtgcaaaacaattaatgatacaagagttatattgccaattagttcat |
168 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||| |||||||| |
|
|
| T |
39105613 |
taagtgcaaaacaattaatgatagaagagttatattgacaagtagttcat |
39105564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 194 - 285
Target Start/End: Complemental strand, 39105485 - 39105394
Alignment:
| Q |
194 |
tcatattaataagtgctcttacaacacttgttaaatattctgaaaatgaaattttatgttgaaaataaaaaatttaaactatttaagaatta |
285 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||| |
|
|
| T |
39105485 |
tcatattaataagtgctcttacaacacttattaaatattctgaaaatgaaattttatgttgaaaataacatttttaaactatttaaaaatta |
39105394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University