View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1699_high_7 (Length: 235)

Name: NF1699_high_7
Description: NF1699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1699_high_7
NF1699_high_7
[»] chr7 (2 HSPs)
chr7 (18-235)||(38894263-38894480)
chr7 (21-223)||(38885080-38885282)
[»] chr1 (2 HSPs)
chr1 (129-233)||(30619594-30619698)
chr1 (135-235)||(30614838-30614938)


Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 38894263 - 38894480
Alignment:
18 cctgctagattccgttctacctgccatggaatatcatccgcatctgggaagcttggggctatggttggtgcgtttgggttcttgcacttggcacagaaca 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
38894263 cctgctagattccgttctacctgccatggaatatcatccgcatctgggaagcttggggctatggttggtgcgtttgggttcttgtacttggcacagaaca 38894362  T
118 aggacaagagtaaagcagatgcagggtaccctgcaggtattggtgtgaagaattcactgcttctcttgggtgtggttaacattttgggattcctttttac 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38894363 aggacaagagtaaagcagatgcagggtaccctgcaggtattggtgtgaagaattcactgcttctcttgggtgtggttaacattttgggattcctttttac 38894462  T
218 tttcttggtgcctgaggc 235  Q
    |||||||||||| |||||    
38894463 tttcttggtgcccgaggc 38894480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 21 - 223
Target Start/End: Original strand, 38885080 - 38885282
Alignment:
21 gctagattccgttctacctgccatggaatatcatccgcatctgggaagcttggggctatggttggtgcgtttgggttcttgcacttggcacagaacaagg 120  Q
    ||||||||||| || || ||||||||||||||||||||||| || ||||||||||||||||||||||| || ||||||||| | |||||||| ||||| |    
38885080 gctagattccgatcaacttgccatggaatatcatccgcatcgggtaagcttggggctatggttggtgcattcgggttcttgtatttggcacaaaacaaag 38885179  T
121 acaagagtaaagcagatgcagggtaccctgcaggtattggtgtgaagaattcactgcttctcttgggtgtggttaacattttgggattcctttttacttt 220  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||| ||||| ||   |||||||||||| ||| | | ||||||    
38885180 acaagagtaaagcagatgcagggtaccctgcaggtattggtatgaagaattcattgattctgttgggagtttgtaacattttggggttcttgtgtacttt 38885279  T
221 ctt 223  Q
    |||    
38885280 ctt 38885282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 129 - 233
Target Start/End: Complemental strand, 30619698 - 30619594
Alignment:
129 aaagcagatgcagggtaccctgcaggtattggtgtgaagaattcactgcttctcttgggtgtggttaacattttgggattcctttttactttcttggtgc 228  Q
    ||||| ||||||||||||||||| |||||||||||||  || ||| || || | || ||||| ||||||||||||||||||  |||||||||||||||||    
30619698 aaagctgatgcagggtaccctgctggtattggtgtgagaaactcattgattttgttaggtgttgttaacattttgggattctgttttactttcttggtgc 30619599  T
229 ctgag 233  Q
    |||||    
30619598 ctgag 30619594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 135 - 235
Target Start/End: Complemental strand, 30614938 - 30614838
Alignment:
135 gatgcagggtaccctgcaggtattggtgtgaagaattcactgcttctcttgggtgtggttaacattttgggattcctttttactttcttggtgcctgagg 234  Q
    ||||||||||||||||| |||||||||||||  || ||| || ||   || ||||  |||| |||||||||||||  |||||||||||||||||||||||    
30614938 gatgcagggtaccctgctggtattggtgtgagaaactcattgttttgtttaggtgctgttaccattttgggattctgttttactttcttggtgcctgagg 30614839  T
235 c 235  Q
    |    
30614838 c 30614838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University