View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1699_high_8 (Length: 234)
Name: NF1699_high_8
Description: NF1699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1699_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 36 - 219
Target Start/End: Complemental strand, 7796722 - 7796546
Alignment:
| Q |
36 |
aaaatggaagcacctgagagctaccatgcatacgagcctgcaagagaacacaaaaaagaatgatgacatttggggttacttctgactattgtgattatct |
135 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7796722 |
aaaatggaagcaccttagagctaccatgcatacaagcctgcaagagaacacaaaacagaaggatgacatttggggttgcttctgactattgtgattatct |
7796623 |
T |
 |
| Q |
136 |
agctataaagaattaatatctatagccatatagatacataacataatgatattctctatgatgggaattgcacatttgtgatgt |
219 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||| |||||| || ||||||| ||||||||||||||||||| |
|
|
| T |
7796622 |
agctataagaaattaatatctatagtcatatagatacataa-----tgatatcct--atgatggtaattgcacatttgtgatgt |
7796546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University