View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1699_high_9 (Length: 228)

Name: NF1699_high_9
Description: NF1699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1699_high_9
NF1699_high_9
[»] chr1 (1 HSPs)
chr1 (9-212)||(35293871-35294074)


Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 9 - 212
Target Start/End: Original strand, 35293871 - 35294074
Alignment:
9 agatgaatgaagtaacagtagagattagaaaaagttaaagaaaaatggaatattatttggtagtttagtttatcataggtatatctagtgttgtttgtga 108  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
35293871 agatgaatgaagtaacagtagagattagaaaaagataaagaaaaatggaatattatttggtaggttagtttatcataggtatatctagtgttgtttgtga 35293970  T
109 cacaagacaaagatttgacggttgatggatgaatgaatcttgataacggaaataggaagacttggcatgcatgctagtttagaggctggcccattagaaa 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
35293971 cacaagacaaagatttgacggttgatggatgaatgaatcttgataacggaaattggaagacttggcatgcatgctagtttagaggctggcccattagaaa 35294070  T
209 ggta 212  Q
    ||||    
35294071 ggta 35294074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University