View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1699_low_6 (Length: 236)
Name: NF1699_low_6
Description: NF1699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1699_low_6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 236
Target Start/End: Original strand, 21830779 - 21830998
Alignment:
| Q |
17 |
atcccggagcagccatccatatatcatagttaggagcaatgccggtagccgggggaagctccggcttccggtgtttggcagggtgaaatgaggagactgc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
21830779 |
atcccggagcagccatccatatatcatagtttggagcaatgccggtagccgggggaagctccggcttccggtgtttggaagggtgaaaggaggagactgc |
21830878 |
T |
|
| Q |
117 |
agaggcaaaggataaccggctattttcataatcatcatcttcatcagaagaagaagctaagtcatcggggacggcggtggagagacggttatatgtttca |
216 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21830879 |
agaggcaaaggataaccggctatcttcataatcatcatcttcatcagaagaagaagctaagtcatcggggacggcggtggagagacggttatatgtttca |
21830978 |
T |
|
| Q |
217 |
aagaaatgtaagtcgtcctc |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
21830979 |
aagaaatgtaagtcgtcctc |
21830998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University