View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1699_low_7 (Length: 235)
Name: NF1699_low_7
Description: NF1699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1699_low_7 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 38894263 - 38894480
Alignment:
| Q |
18 |
cctgctagattccgttctacctgccatggaatatcatccgcatctgggaagcttggggctatggttggtgcgtttgggttcttgcacttggcacagaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38894263 |
cctgctagattccgttctacctgccatggaatatcatccgcatctgggaagcttggggctatggttggtgcgtttgggttcttgtacttggcacagaaca |
38894362 |
T |
 |
| Q |
118 |
aggacaagagtaaagcagatgcagggtaccctgcaggtattggtgtgaagaattcactgcttctcttgggtgtggttaacattttgggattcctttttac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38894363 |
aggacaagagtaaagcagatgcagggtaccctgcaggtattggtgtgaagaattcactgcttctcttgggtgtggttaacattttgggattcctttttac |
38894462 |
T |
 |
| Q |
218 |
tttcttggtgcctgaggc |
235 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
38894463 |
tttcttggtgcccgaggc |
38894480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 21 - 223
Target Start/End: Original strand, 38885080 - 38885282
Alignment:
| Q |
21 |
gctagattccgttctacctgccatggaatatcatccgcatctgggaagcttggggctatggttggtgcgtttgggttcttgcacttggcacagaacaagg |
120 |
Q |
| |
|
||||||||||| || || ||||||||||||||||||||||| || ||||||||||||||||||||||| || ||||||||| | |||||||| ||||| | |
|
|
| T |
38885080 |
gctagattccgatcaacttgccatggaatatcatccgcatcgggtaagcttggggctatggttggtgcattcgggttcttgtatttggcacaaaacaaag |
38885179 |
T |
 |
| Q |
121 |
acaagagtaaagcagatgcagggtaccctgcaggtattggtgtgaagaattcactgcttctcttgggtgtggttaacattttgggattcctttttacttt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||| ||||| || |||||||||||| ||| | | |||||| |
|
|
| T |
38885180 |
acaagagtaaagcagatgcagggtaccctgcaggtattggtatgaagaattcattgattctgttgggagtttgtaacattttggggttcttgtgtacttt |
38885279 |
T |
 |
| Q |
221 |
ctt |
223 |
Q |
| |
|
||| |
|
|
| T |
38885280 |
ctt |
38885282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 129 - 233
Target Start/End: Complemental strand, 30619698 - 30619594
Alignment:
| Q |
129 |
aaagcagatgcagggtaccctgcaggtattggtgtgaagaattcactgcttctcttgggtgtggttaacattttgggattcctttttactttcttggtgc |
228 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||| || ||| || || | || ||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30619698 |
aaagctgatgcagggtaccctgctggtattggtgtgagaaactcattgattttgttaggtgttgttaacattttgggattctgttttactttcttggtgc |
30619599 |
T |
 |
| Q |
229 |
ctgag |
233 |
Q |
| |
|
||||| |
|
|
| T |
30619598 |
ctgag |
30619594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 135 - 235
Target Start/End: Complemental strand, 30614938 - 30614838
Alignment:
| Q |
135 |
gatgcagggtaccctgcaggtattggtgtgaagaattcactgcttctcttgggtgtggttaacattttgggattcctttttactttcttggtgcctgagg |
234 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || ||| || || || |||| |||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30614938 |
gatgcagggtaccctgctggtattggtgtgagaaactcattgttttgtttaggtgctgttaccattttgggattctgttttactttcttggtgcctgagg |
30614839 |
T |
 |
| Q |
235 |
c |
235 |
Q |
| |
|
| |
|
|
| T |
30614838 |
c |
30614838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University