View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1699_low_9 (Length: 228)
Name: NF1699_low_9
Description: NF1699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1699_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 9 - 212
Target Start/End: Original strand, 35293871 - 35294074
Alignment:
| Q |
9 |
agatgaatgaagtaacagtagagattagaaaaagttaaagaaaaatggaatattatttggtagtttagtttatcataggtatatctagtgttgtttgtga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35293871 |
agatgaatgaagtaacagtagagattagaaaaagataaagaaaaatggaatattatttggtaggttagtttatcataggtatatctagtgttgtttgtga |
35293970 |
T |
 |
| Q |
109 |
cacaagacaaagatttgacggttgatggatgaatgaatcttgataacggaaataggaagacttggcatgcatgctagtttagaggctggcccattagaaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35293971 |
cacaagacaaagatttgacggttgatggatgaatgaatcttgataacggaaattggaagacttggcatgcatgctagtttagaggctggcccattagaaa |
35294070 |
T |
 |
| Q |
209 |
ggta |
212 |
Q |
| |
|
|||| |
|
|
| T |
35294071 |
ggta |
35294074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University