View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1700-Insertion-3 (Length: 249)
Name: NF1700-Insertion-3
Description: NF1700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1700-Insertion-3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 138
Target Start/End: Original strand, 38346578 - 38346608
Alignment:
| Q |
108 |
cttttagggatatttaactagagatccctta |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38346578 |
cttttagggatatttaactagagatccctta |
38346608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 40
Target Start/End: Original strand, 38346482 - 38346510
Alignment:
| Q |
12 |
tatggtttattgaaatttttgctttctgc |
40 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38346482 |
tatggtttattgaaatttttgctttctgc |
38346510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University