View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17000_high_14 (Length: 201)
Name: NF17000_high_14
Description: NF17000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17000_high_14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 59 - 201
Target Start/End: Complemental strand, 42844396 - 42844254
Alignment:
| Q |
59 |
gacacgactaagtgaaacctaagaagaccgccgctaacgcctgtaaatcattaaatgcttgaagaagttcataatatcgactcttatagtgctcaagtga |
158 |
Q |
| |
|
||||||||| | || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42844396 |
gacacgactcaatgcaaccttagaagaccgccgctaacgcctgtaaatcattaaatgcttgaagaagttcataatatcgactcttatagtgctcaagtga |
42844297 |
T |
 |
| Q |
159 |
ataacttagttgtctaattgcctccttcttctcctcagccaca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42844296 |
ataacttagttgtctaattgcctccttcttctcctcggccaca |
42844254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 132 - 198
Target Start/End: Complemental strand, 12622913 - 12622847
Alignment:
| Q |
132 |
atatcgactcttatagtgctcaagtgaataacttagttgtctaattgcctccttcttctcctcagcc |
198 |
Q |
| |
|
|||| ||||| |||| || |||| ||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12622913 |
atatagactcctataatgatcaacagaaaaacttagttgtctaattgcctccctcttctcctcagcc |
12622847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 132 - 198
Target Start/End: Complemental strand, 12628839 - 12628773
Alignment:
| Q |
132 |
atatcgactcttatagtgctcaagtgaataacttagttgtctaattgcctccttcttctcctcagcc |
198 |
Q |
| |
|
|||||||||| |||||| |||||| ||| | | || |||||||||||||||| |||||||||||||| |
|
|
| T |
12628839 |
atatcgactcctatagtactcaagggaaaagcataattgtctaattgcctccctcttctcctcagcc |
12628773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University