View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17000_low_15 (Length: 242)
Name: NF17000_low_15
Description: NF17000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17000_low_15 |
 | |
|
| [»] scaffold0011 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0011 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 240448 - 240235
Alignment:
| Q |
1 |
cgcactcaatgataccacttttttaggttaatttctaaaacatctctataactaattacttggcatgttttgattagatgcaatataagcaagtaaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
240448 |
cgcactcaatgataccacttttttgggttaatttctaaaatatctctataactaattacttggcatgttttgattagatgcaatataagtaagt-aaaat |
240350 |
T |
|
| Q |
101 |
agtcacataaaatatgccacacacatacnnnnnnncacccatatcaagtcaaatacacaagcatcctctaatatccaaggaccgtccttcttcatttgat |
200 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
240349 |
agtcacat--aatatgccacacacatacaaaaaaacacccatatcaagtcaaatacacaagcatcctctaatatccaaggaccgtccttctccatttgat |
240252 |
T |
|
| Q |
201 |
gcaacatgattacatga |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
240251 |
gcaacatgattacatga |
240235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 45
Target Start/End: Original strand, 44599484 - 44599522
Alignment:
| Q |
7 |
caatgataccacttttttaggttaatttctaaaacatct |
45 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
44599484 |
caatgataccacttctttaggttaatttctaaaatatct |
44599522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University