View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17000_low_8 (Length: 348)
Name: NF17000_low_8
Description: NF17000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17000_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 1e-32; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 116 - 226
Target Start/End: Original strand, 2428938 - 2429049
Alignment:
| Q |
116 |
gtataaactaattagttcac-gaaatctacattaagatatttaaacatgagaatttgaaaggaaacacactttaagacctcgaaccaacatgattggatt |
214 |
Q |
| |
|
|||||| |||| |||||||| |||||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
2428938 |
gtataagctaactagttcactgaaatcgacattaaggtatttaaacatgagaatttgaaaggaaacacacttcaagacctcgaaccaacatgattggact |
2429037 |
T |
|
| Q |
215 |
gatccaaatgag |
226 |
Q |
| |
|
|| |||||||| |
|
|
| T |
2429038 |
gacacaaatgag |
2429049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 2428852 - 2428948
Alignment:
| Q |
1 |
cttgtaataaataaataagtttttctttaggta--actaatccaacatatccaatttcacttttctatttatggagtcacgtttaaatataaactaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||| ||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
2428852 |
cttgtaataaataaataagtttttctttaggaacgactaatccaacgtatccaatttcacctttctatttatggagtcacgtttaagtataagctaa |
2428948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 2429118 - 2429162
Alignment:
| Q |
295 |
ctagattaaagatcaacaatgtgaatgtgagtggtgatgtgatga |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429118 |
ctagattaaagatcaacaatgtgaatgtgagtggtgatgtgatga |
2429162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University