View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17001_high_11 (Length: 323)
Name: NF17001_high_11
Description: NF17001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17001_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 38 - 317
Target Start/End: Original strand, 46499738 - 46500004
Alignment:
| Q |
38 |
tggtttttggtcgtctgcatcattcactcaccaggtttgtggtggtgccggtgcgcagcgactcgtggtggttttcggggaccctcttggatggatggtt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46499738 |
tggtttttggtcgtctgcatcattcactcaccaggtttgtggtggtgccggtgcgcagcgactcgtggtggttttcggggaccctcttggatggatggtt |
46499837 |
T |
 |
| Q |
138 |
cacaggggtagatctagattcagatctctcagtgactggttctccgtcctccatcactgttcgggttttgctttttcggtggcggcattgggtggtgttg |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46499838 |
cacaggggtagatctagattcagatctctcagtggctggttctccgtcctccatcactgttcgggttttgctttttc-------------ggtggtgttg |
46499924 |
T |
 |
| Q |
238 |
gtaaattatgtctgatacgtatgcatgcatgctttataacgatgtttcaaaatggttcatgcctgaacttgtatattctt |
317 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46499925 |
gtaaattatgtctgattcgtatgcatgcatgctttataacgatgtttcaaaatggttcatgcctgaacttgtattttctt |
46500004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University