View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17001_low_14 (Length: 305)
Name: NF17001_low_14
Description: NF17001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17001_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 20 - 293
Target Start/End: Original strand, 10996263 - 10996536
Alignment:
| Q |
20 |
cctactaccactcatcacataaccaagttcctcaaacttcgaaatctcctccgcagaaagacccacttctcctctccgaggaatacgtttcccttgttga |
119 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10996263 |
cctactaccgctcatcacataaccaagttcctcaaacttcgaaatctcctccgcagaaagacccacttctcctctccggggaatacgtttcccttgttga |
10996362 |
T |
|
| Q |
120 |
acatattgcgcaatagcatctccttcacctggcctaagcgcaccaccataacttatatgcccctcagctcttggaagcggcattggtccaaccggtggtt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10996363 |
acatattgcgcaatagcatctccttcacccggcctaagcgcaccaccataacttatatgcccctcagctcttggaagcggcattggtccaaccggtggtt |
10996462 |
T |
|
| Q |
220 |
catcatcatccaaagccggtttcttctgtgactcaaacaattccttcaacttcaaagcctcggcattcatctca |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10996463 |
catcatcatccaaagccggtttcttctgtgactcaaacaattccttcaacttcaaagcctcagcattcatctca |
10996536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University