View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17001_low_18 (Length: 244)
Name: NF17001_low_18
Description: NF17001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17001_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 102 - 228
Target Start/End: Complemental strand, 7610096 - 7609971
Alignment:
| Q |
102 |
tcctaggtgtgaatgaagctagcaataaaaaacttccacataattctccctttggaagactaaagaggaaaagaaaatgtggttagcttctttgtgataa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7610096 |
tcctaggtgtgaatgaagctagcaataaaaaacttccacataattctccctttggaagact-aagaggaaatgaaaatgtggttagcttctttgtgataa |
7609998 |
T |
 |
| Q |
202 |
gttgagttataattcttttctagaaac |
228 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
7609997 |
gttgagttataattcttttctagaaac |
7609971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University