View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17002_high_14 (Length: 388)
Name: NF17002_high_14
Description: NF17002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17002_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 54 - 375
Target Start/End: Complemental strand, 23945386 - 23945065
Alignment:
| Q |
54 |
tactttaatgctagcattagaagagttaatttgggagggtttgtacccgctcctattttcatgcatatgatcgtatttttcagcattcaattcattaatt |
153 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23945386 |
tactttaatgcttgcattagaagagttaatttgggagggtttgtaaccgctccttatttcatgcatatgatcgtatttttcagcattcaattcattaatt |
23945287 |
T |
 |
| Q |
154 |
cttttcttaagattttgaaatgatgtacctttcatgtctgcaccagcaatgcgtgacccagccttattgactcgnnnnnnnctttccactttaatccact |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
23945286 |
cttttcttaagattttgaaatgatgtacctttcatgtctgcaccagcaatgcgtgaaccaaccttattgactcgtttttttctttccactttaatccact |
23945187 |
T |
 |
| Q |
254 |
caccatgcaaagaatccggttcaccattaatacccaagatatcagttttgaacggaaactcctccatcattattcctgatttttcgtttttaccgttacc |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23945186 |
caccatgcaaagaatccggttcaccattaatacccaagatatcagttttgaacggaatctcctccatcattattcctgatttttcgtttttaccgttacc |
23945087 |
T |
 |
| Q |
354 |
cacattaaagttgttaccgttc |
375 |
Q |
| |
|
|||||||| ||||||| ||||| |
|
|
| T |
23945086 |
cacattaatgttgttatcgttc |
23945065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University