View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17002_high_22 (Length: 309)
Name: NF17002_high_22
Description: NF17002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17002_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 31860668 - 31860488
Alignment:
| Q |
1 |
atagttaaatgttattagatatgttttagaatggttcaatcactctttaaatcagttcaaccgattttaaaagtgctcactaacacataacagtctttga |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
31860668 |
atagttaaatgttattagatattttttagaacggttcaatcactctttaaatgaattcaaccgattttaaaagtgctcactaacacttaatagtctttga |
31860569 |
T |
|
| Q |
101 |
aaagtcgaacgatagttaactgctgttgagtcaacgacagtcgacaaaaagtagtttgagaagtaagaaaagtaatatcca |
181 |
Q |
| |
|
||| ||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31860568 |
aaaatcgaacgatggttaaccgccgttgagtcaacgacagtcgacaaaaagtagtttgagaagtaagaaaagtaatatcca |
31860488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 33 - 75
Target Start/End: Complemental strand, 34273182 - 34273140
Alignment:
| Q |
33 |
ggttcaatcactctttaaatcagttcaaccgattttaaaagtg |
75 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
34273182 |
ggttcaatcactgtttaagtcggttcaaccgattttaaaagtg |
34273140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 34673878 - 34673817
Alignment:
| Q |
18 |
gatatgttttagaatggttcaatcactctttaaatcagttcaaccgattttaaaagtgctca |
79 |
Q |
| |
|
||||| ||||||| ||||||||||||| |||||||| ||| |||| |||| |||||| |||| |
|
|
| T |
34673878 |
gatattttttagattggttcaatcactttttaaatcggtttaaccaatttaaaaagttctca |
34673817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 32 - 76
Target Start/End: Complemental strand, 5815166 - 5815122
Alignment:
| Q |
32 |
tggttcaatcactctttaaatcagttcaaccgattttaaaagtgc |
76 |
Q |
| |
|
||||||||||||| ||||| |||| ||||||||| |||||||||| |
|
|
| T |
5815166 |
tggttcaatcactttttaagtcaggtcaaccgatcttaaaagtgc |
5815122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 124
Target Start/End: Original strand, 11442735 - 11442835
Alignment:
| Q |
24 |
ttttagaatggttcaatcactctttaaatcagttcaaccgattttaaaagtgctcactaacacataacagtctttgaaaagtcgaacgatagttaactgc |
123 |
Q |
| |
|
||||||||||||||||||| | ||||||| ||| || |||| |||||| | ||| | |||| |||| || ||||||||||||||| || |||||||| |
|
|
| T |
11442735 |
ttttagaatggttcaatcattttttaaattggtttaatcgatcttaaaaattttcaatgacacttaactatcgttgaaaagtcgaacgttatttaactgc |
11442834 |
T |
|
| Q |
124 |
t |
124 |
Q |
| |
|
| |
|
|
| T |
11442835 |
t |
11442835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University