View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17002_high_31 (Length: 249)
Name: NF17002_high_31
Description: NF17002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17002_high_31 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 119 - 249
Target Start/End: Original strand, 6189423 - 6189553
Alignment:
| Q |
119 |
tggttacttgcacgtcaagtcatcgactctaactaacttgaattgctcatttctcaacataccaccttaattcatgttagtcaatgattcgattcccatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6189423 |
tggttacttgcacgtcaagtcatcgactctaactaacttgaattgctcatttctcaacataccaccttaattcatgttagtcaatgattcgattcccatt |
6189522 |
T |
 |
| Q |
219 |
aaaaatatctcggtttcttaaacacttcgat |
249 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |
|
|
| T |
6189523 |
aaaaatatctcagtttcttaaacacttcgat |
6189553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 11 - 76
Target Start/End: Original strand, 6189315 - 6189380
Alignment:
| Q |
11 |
atcatcactaggtatttatacacttgcacaaatccacacacaattggatctcaaccaaaagggttg |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6189315 |
atcatcactaggtatttatacacttgcacaaatccacacacaattggatctcaaccaaaagggttg |
6189380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 220
Target Start/End: Complemental strand, 29117224 - 29117185
Alignment:
| Q |
181 |
caccttaattcatgttagtcaatgattcgattcccattaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
29117224 |
caccttaattcatgttagtcaatgatacaattcccattaa |
29117185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University