View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17002_high_32 (Length: 243)
Name: NF17002_high_32
Description: NF17002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17002_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 144 - 237
Target Start/End: Original strand, 2069117 - 2069210
Alignment:
| Q |
144 |
gaaggttgaatggtacaactcaactgcccttgtgttcccccttggagcaagtgttataggcctccttccgagcaatgattgattttcttctcac |
237 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2069117 |
gaaggttgaatggtacaactcaaccgcccttgtgttcccccttggagcaagtgttataggcctccttcggagcaatgattgattttcttctcac |
2069210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 158 - 237
Target Start/End: Original strand, 2073477 - 2073556
Alignment:
| Q |
158 |
acaactcaactgcccttgtgttcccccttggagcaagtgttataggcctccttccgagcaatgattgattttcttctcac |
237 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2073477 |
acaactcaaccgcccttgtgttcccccttggagcaagtgttataggcctccttcggagcaatgattgattttcttctcac |
2073556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 2068985 - 2069029
Alignment:
| Q |
19 |
aaagaaccctcatcttctgtctctcacttacaagatatattatta |
63 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
2068985 |
aaagaaccctcatcctctctctctcacttataagatatattatta |
2069029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University