View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17002_low_38 (Length: 213)
Name: NF17002_low_38
Description: NF17002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17002_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 6 - 156
Target Start/End: Original strand, 4504520 - 4504668
Alignment:
| Q |
6 |
ttttcttcttatattcttgaacttgttgtattgttttgtgttttattgaaattattgtgtgctattgtctcgtcaatattctcaggnnnnnnnnnnatgg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4504520 |
ttttcttcttatattcttgaacttgttgtattgttttgtgttttattgaaattattgtgtgctattgtctcgtcaatattctcagg--ttttttttatgg |
4504617 |
T |
 |
| Q |
106 |
aaaagctgcttcaactgaattaacttttttaacaaattcaagtttttccct |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4504618 |
aaaagctgcttcaactgaattaacttttttaacaaattcaagtttttccct |
4504668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University