View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17002_low_40 (Length: 202)
Name: NF17002_low_40
Description: NF17002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17002_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 54 - 188
Target Start/End: Complemental strand, 23945386 - 23945252
Alignment:
| Q |
54 |
tactttaatgctagcattagaagagttaatttgggagggtttgtacccgctcctattttcatgcatatgatcgtatttttcagcattcaattcattaatt |
153 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23945386 |
tactttaatgcttgcattagaagagttaatttgggagggtttgtaaccgctccttatttcatgcatatgatcgtatttttcagcattcaattcattaatt |
23945287 |
T |
 |
| Q |
154 |
cttttcttaagattttgaaatgatgtacctttcat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
23945286 |
cttttcttaagattttgaaatgatgtacctttcat |
23945252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University