View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17003_high_22 (Length: 301)
Name: NF17003_high_22
Description: NF17003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17003_high_22 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 21 - 301
Target Start/End: Original strand, 6775299 - 6775579
Alignment:
| Q |
21 |
acatcatcagggtttggagggcttgggttggaaggaatggtgggaatgtcagagcctgtaggagttggtaaagcaccaccaggagaaggcaaaagtggag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6775299 |
acatcatcagggtttggagggcttgggttggaaggaatagtgggaatgtcagagcctgtaggagttggcaaagcaccaccaggagaaggcaaaagtggag |
6775398 |
T |
|
| Q |
121 |
caatttctggtgacagattttggaaaggagagattgaagatggagaaggatctgtttttgttgctgatgaagtagtggggagtgttggaagttcaggaat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6775399 |
caatttctggtgacagattttggaaaggagagattgaagatggagaaggatctgtttttgttgctgatgaagtagtggggagtgttggaagttcaggaat |
6775498 |
T |
|
| Q |
221 |
aggatctgattgtgaatatgatgaaaggataggtgaaggcatgaaaagcatgatgatcattagtactggataaactgtgaa |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||| |
|
|
| T |
6775499 |
aggatctgattgtgaatatgatgaaaggataggtgaaggcatgaaaaccatgatgatcattagtactgcagaaactgtgaa |
6775579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University