View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17003_high_7 (Length: 362)
Name: NF17003_high_7
Description: NF17003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17003_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 22 - 298
Target Start/End: Complemental strand, 6027214 - 6026937
Alignment:
| Q |
22 |
catcatcaacaagatttttgcttcagccgttaaagaacttccacagcgcacgttagcaaccatagcccaaacgcgaaaaaagaagaagaatcactttttt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027214 |
catcatcaacaagatttttgcttcagccgttaaagaacttccacggcgcacgttagcaaccatagcccaaacgcgaaaaaagaagaagaatcactttttt |
6027115 |
T |
|
| Q |
122 |
-aatcgattcttcaaacttttttccttccaatatcaattaacatcccactcatcagaactctctggttcaggaatcttattcaaatcaactctctcagca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027114 |
taatcgattcttcaaacttttttccttccaatatcaattaacatcccactcatcagaactctctggttcaggaatcttattcaaatcaactctctcagca |
6027015 |
T |
|
| Q |
221 |
aaatcaccagaaccatcaccttcaagcaactccggaaccggcataacacgatgatgctggttccggttatgctgaagg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027014 |
aaatcaccagaaccatcaccttcaagcaactccggaaccggcataacacgatgatgctggttccggttatgctgaagg |
6026937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University