View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17004_high_25 (Length: 330)

Name: NF17004_high_25
Description: NF17004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17004_high_25
NF17004_high_25
[»] chr1 (2 HSPs)
chr1 (140-303)||(10379500-10379663)
chr1 (1-105)||(10379691-10379795)


Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 140 - 303
Target Start/End: Complemental strand, 10379663 - 10379500
Alignment:
140 gcaacaatttaacactaggtcagaggctcgctgagggcaatgcgagcgatgcaaattcaaaaaacactatcctattaaatataacggaaaaatgcaatat 239  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
10379663 gcaacaatttaacactagttcagaggctcgctgagggcaatgcgagcgatgcaaattcaaaaaacactatcctaataaatataacggaaaaatgcaatat 10379564  T
240 atttataaataagccatattatatctagttaaatcaatattgtattattaacatagtgatgatg 303  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
10379563 atttataaataagccatattatatctagttaaatcaatattgtactattaacatagtgatgatg 10379500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 10379795 - 10379691
Alignment:
1 aagcatacgagagaggcatcggagagtgttttgagttgcaacagaatgcagttttccatcagatggccatatggaactggcttctccaccctgactctca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10379795 aagcatacgagagaggcatcggagagtgttttgagttgcaacagaatgcagttttccatcagatggccatatggaactggcttctccaccctgactctca 10379696  T
101 gttgg 105  Q
    |||||    
10379695 gttgg 10379691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University