View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17007_high_19 (Length: 226)
Name: NF17007_high_19
Description: NF17007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17007_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 16 - 210
Target Start/End: Original strand, 15574756 - 15574951
Alignment:
| Q |
16 |
aatatgcaccccaatagctcatcaaattacaatgatacatcatccaaataacctgataaaaaacttattaaatggaaaatgttttactaaaataaga-tt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
15574756 |
aatatgcaccccaatagctcatcaaattacaatgatacatcatccaaataacctgataaaaaacttattaaatggaaaatgttttactaaaataagattt |
15574855 |
T |
 |
| Q |
115 |
aacaaatgagtatcgtggttgtcaagaacaaatcctactttgaattactgaacaacttttctgttgtagaagatgcaagtgatagatacttctttc |
210 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15574856 |
atcaaatgagtatcgtggttgtcaagaacaaatcctactttgaattactgaacaacttttctgttgtagaagatgcaagtgatagatacttctttc |
15574951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 69
Target Start/End: Complemental strand, 8339791 - 8339757
Alignment:
| Q |
35 |
catcaaattacaatgatacatcatccaaataacct |
69 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
8339791 |
catcaaattacaatgatatatcatccaaataacct |
8339757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University